当前位置:首页 >> 农林牧渔 >>

Expression of full-length bioactive antimicrobial human lactoferrin in


Transgenic Research 9: 71–78, 2000. ? 2000 Kluwer Academic Publishers. Printed in the Netherlands.

71

Short Communication

Expression of full-length bioactive

antimicrobial human lactoferrin in potato plants
Daniel K.X. Chong1 & William H.R. Langridge1,2,?
for Molecular Biology and Gene Therapy, Loma Linda, CA 92350
1 Center 2 Department

of Biochemistry, Loma Linda University,

Received 24 June 1999; revised 19 January 2000; accepted 20 January 2000

Key words: human lactoferrin, potato, transgenic plants Abstract A cDNA fragment encoding human lactoferrin (hLF) linked to a plant microsomal retention signal peptide (SEKDEL) was stably integrated into the Solanum tuberosum genome by Agrobacterium tumefaciens-mediated leaf disk transformation methods. The lactoferrin gene was expressed under control of both the auxin-inducible manopine synthase (mas) P2 promoter and the cauli?ower mosaic virus (CaMV) 35S tandem promoter. The presence of the hLF cDNA in the genome of regenerated transformed potato plants was detected by polymerase chain reaction ampli?cation methods. Full-length hLF protein was identi?ed by immunoblot analysis in tuber tissue extracts from the transformed plants by immunoblot analysis. The hLF produced in transgenic plant tissues migrated during polyacrylamide gel electrophoresis as a single band with an approximate molecular mass equal to hLF. Auxin activation of the mas P2 promoter increased lactoferrin expression levels in transformed tuber and leaf tissues to approximately 0.1% of total soluble plant protein. Antimicrobial activity against four different human pathogenic bacterial strains was detected in extracts of lactoferrin-containing potato tuber tissues. This is the ?rst report of synthesis of full length, biologically active hLF in edible plants. Introduction Lactoferrin is an iron-binding glycoprotein found in high concentration in mammalian milks and to a lesser extent, in exocrine ?uids such as bile and tears (Masson et al., 1968). The human lactoferrin (hLF) molecule contains about 700 amino acid residues (Mr approximately 80,000), folded into two globular lobes (Legrand et al., 1984). Each lobe binds a single Fe3+ ion and one CO2? ion (Anderson et al., 1989). Both 3 lobes are conjugated to one poly-N-acetyllactosaminic glycan through an N-glucosidic linkage (Spik et al., 1982). Lactoferrin plays a signi?cant protective role in human milk. Based on its iron-chelating properties, lactoferrin impedes bacterial iron utilization causing bacteriostasis (Arnold et al., 1981). hLF protein also contains a speci?c antimicrobial domain consistFax: +1 909 478 4177; E-mail: blangridge@som.llu.edu
? Author for correspondence: Tel.: +1 909 824 4300 ext. 81362;

ing of a loop of 18 amino acid residues (Bellamy et al., 1992). This peptide region signi?cantly inhibits growth of E. coli (Saito et al., 1991) and is distinct from the iron-binding region (Bellamy et al., 1992). Lactoferrin is also important in the regulation of myelopoiesis (Broxmeyer et al., 1991), the modulation of in?ammatory responses (Oseas et al., 1981), as an essential growth factor for lymphocytes (Hashizume et al., 1983), in DNA binding (Bennet and Davis, 1982) and in RNase cleavage (Furmanski et al., 1989). The potential for lactoferrin to act both as an antimicrobial and an immune regulatory agent in addition to its nutritional and pharmaceutical value has stimulated considerable interest in development of an expression system which can provide large amounts of biologically active recombinant lactoferrin protein. Recombinant hLF has been synthesized in lower eukaryotes, such as Saccharomyces cerevisiae (Liang & Richardson, 1993), and in a variety of mammalian systems, including baby hamster cells (Stowel et al.,

72 1991) and human 293 cells (van Berkel et al., 1995), transgenic cows and mice (Platenburg et al., 1994; Nuijens et al. 1997). High levels of recombinant lactoferrin expression have been obtained as a fusion protein in Aspergillus (Ward et al., 1992). However, animal and fungal production systems require expensive puri?cation processes. Based on the availability of large numbers of transformed plants generating lactoferrin using sunlight as an inexpensive light source, the expression of lactoferrin in transgenic plants provides an attractive production system. In addition, due to their photoautotrophic nature, plants require only water, CO2 , soil minerals, nitrogen, and sunlight energy for synthesis of recombinant proteins and plants do not harbor harmful mammalian disease-causing viruses, microbes, fungi and prions of animal cell origin. The goal of our research program is the introduction of major nutritional and therapeutic human milk proteins into edible food plants for improvement of infant nutrition for protection against infectious and autoimmune diseases. In 1997, we expressed human milk protein, β casein in potatoes (Chong et al., 1997). In this report, we demonstrate for the ?rst time the biosynthesis of full length, biologically active hLF in the tubers of regenerated normal phenotypic transgenic potato plants. Materials and methods Construction of plant expression vectors containing hLF Plasmid pGEMhLFc containing the 2.3-kb full length hLF cDNA fragment was kindly provided by Dr. Orla M. Conneely at the Baylor College of Medicine, Houston, Texas. hLF cDNA was ampli?ed from pGEMhLFc by the polymerase chain reaction ampli?cation method as a BamH I fragment inserted into the BamH I cloning site of plant expression vectors pPCV702E and pPCV701. The resulting plasmids were named pPCV701hLF and pPCV702EhLF, respectively (Figure 1). The oligonucleotide primers were synthesized in the DNA core facility at the Center for Molecular Biology and Gene Therapy, Loma Linda University, on a model 394 DNA/RNA synthesizer (Applied Biosystems, Inc.). A BamH I site was incorporated into the oligonucleotide 5 primer (5 -CGGGATCCGACCGCAATGAAACTT-3 ). In addition to a BamH I site, the oligonucleotide 3 primer (5 -CGGGATCCTTATAGCTCATCTTTCTCAGACTTTCCTGAGGAATTCACAG-3 ) was designed to

Figure 1. Structure of plant expression vector pPCV701hLF and pPCV702EhLF. Both vectors carry the Agrobacterium tumefaciens left and right 25 bp direct repeats (LB and RB) of the transferred DNA (T-DNA), bordering the DNA fragment incorporated into plant genome. In pPCV701hLF, the human lactoferrin:SEKDEL fusion gene was placed immediately downstream of mas P2 promoter. The lactoferrin:SEKDEL gene is followed by the polyadenylation sequence of TL -DNA gene 7 (g7pA). In pPCV702EhLF, lactoferrin:SEKDEL DNA fragment was placed under control of the CaMV enhanced 35S promoter (35SE) followed by the polyadenylation signal of the nopaline synthase gene (NOSpA). Arrows indicate the direction of transcription. pNOS is the promoter from the nopaline synthase gene; NPTII, is the neomycin phosphotransferase gene from transposon Tn5 used for selection of transformed plants; g4pA, is the polyadenylation signal of Agrobacterium tumefaciens octopine strain TL-DNA gene 4; Ori plasmid pBR322, is the replication origin of pBR322, Bla, is the β-lactamase gene conferring resistance to ampicillin for selection in E. coli.

contain a nucleotide sequence encoding the hexapeptide plant endoplasmic reticulum retention signal (SEKDEL) in frame with the hLF open reading frame. The hLF:SEKDEL fusion gene was inserted adjacent to the enhanced cauli?ower mosaic virus 35S (CaMV 35SE) gene promoter (Odell et al., 1985) in plant expression vector pPCV702EhLF and, behind the Agrobacterium mannopine synthase (mas) gene P2 promoter (Velten et al., 1984) in plasmid pPCV701hLF. Transformation of potato cells Agrobacterium tumefaciens mediated plant cell transformation was performed as described by Chong et al. (1997) with minor modi?cations. Sterile leaf explants of S. tuberosum cv. Bintje were infected by A. tumefaciens strain GV3010 MP90RK harboring either plasmid pPCV701hLF or pPCV702EhLF. Plant cell transformation was carried out by incubating leaf explants in approximately 1 × 109 vector carrying A. tumefaciens cells per milliltre of Murashige and Skoog (MS) medium for 10 min at room temperature. The explants were then transferred to solid MS medium containing naphthalene acetic acid (NAA, 1 mg/l) and 0.2% gelrite for 2–3 days to achieve T-

73 DNA transfer into the plant genome. The leaf explants were then placed on a callus growth medium containing plant growth hormones and antibiotics, 0.1 mg/l NAA and 1 mg/l trans zeatin, 50 mg/l kanamycin and 300 mg/l claforan. The explants were incubated in a light room at 27? C with an illumination intensity of 12 ?E and a 12-h photoperiod for 2–3 weeks to generate callus tissue. Leaf explants containing friable callus tissues were transferred to callus growth medium minus NAA for an additional 2–3 weeks to facilitate shoot formation. Regenerated shoots were rooted in the medium without plant growth hormones. Roots regenerated from the shoots after 2–3 weeks further incubation and the small plantlets were transferred to Magenta boxes for tuberization, or to sterile soil for growth to maturity in the greenhouse (3 months). Detection of the lactoferrin gene in transformed plants The hLF:SEKDEL fusion gene was detected in the genomic DNA of the putative transgenic plants using the polymerase chain reaction with a set of primers ?anking the lactoferrin gene (Chong et al., 1997). The 5 forward primer is located upstream of the CaMV 35SE or mas P2 promoters and the 3 reverse primer is located within the polyadenylation region of TL DNA gene 7 (g7pA) of the pPCV701hLF vector, or the nopaline termination region of the pPCV702hLF vector (Figure 1). The DNA primers were designed to amplify DNA inserts placed under the control of CaMV 35SE or mas P2 promoters. Plant genomic DNA was isolated from both leaf and tuber tissues of transgenic potato plants using a plant DNA isolation kit (Boehringer–Mannheim). Immunoblot detection of lactoferrin protein in transformed plants Total soluble protein was extracted from transformed potato tuber tissue by homogenization with a mortar and pestle on ice at 4? C in an extraction buffer containing 50 mM Tris–HCl (pH 7.5), 2 mM EDTA, 0.5 mM EGTA, 1 mM PMSF and 1% Triton X-100. The homogenates were centrifuged in a Beckman GS15R tabletop centrifuge at 14,000 rpm for 10 min at 4? C. The soluble protein concentration in the homogenate supernatant was determined (Bradford, 1976). Approximately 100 ?g total protein from each sample was boiled for 5 min and loaded in the wells of a 10% polyacrylamide gel. The protein bands were separated by polyacrylamide gel electrophoresis, and transferred onto a nitrocellulose membrane by electroblotting with a semi-dry blotter (Labconco Inc.). The damp membrane was blocked with 1% BSA and 20% fetal calf serum in TBST buffer (10 mM Tris–HCl pH 8.0, 150 mM NaCl and 0.05% Tween 20) for at least 1 h at room temperature. The blocked membrane was incubated for 3 h to overnight in TBST solution containing a 1:1000 dilution of a commercially available rabbit anti-hLF antibody (Sigma). The anti-hLF primary antibody/recombinant hLF antigen complex was reacted with a secondary antibody by incubating the membrane in a 1:3000 TBST dilution of a goat antirabbit IgG alkaline phosphatase conjugate (BioRad Inc). The recombinant protein was visualized by a colorimetric reaction in which the membrane was incubated in a BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrate solution for 10–30 min at room temperature prior to photography of the purple reaction product. Assessment of lactoferrin antibacterial activity To determine the effect of tuber-synthesized recombinant hLF on the inhibition of bacterial growth, total cellular protein was extracted from transgenic tuber tissues in a protein extraction buffer with the exception that EDTA and EGTA were omitted. Three human pathogenic bacterial strains, Escherichia coli (Migula) (ATCC 35218), Staphylococcus aureus (ATCC 29213), Salmonella paratyphi and a laboratory E. coli strain DH5α were selected for the growth inhibition assay. The bacterial strains were grown to an optical density (A600 ) of 0.4, and aliquots of 1 ml were transferred to culture tubes. Total cellular protein (500 ?g) from tuber tissues of selected transgenic potato plants was added to each culture tube. Commercially available lactoferrin (Sigma) and extracts from potato tuber tissues of plants transformed with plasmid vectors minus the lactoferrin gene was used as positive and negative controls, respectively. The mixture of bacterial cells and plant extracts were then incubated at 37?C on a rotary shaker at 250 rpm for 1–2 h until the A600 reached 0.8–1. The total number of colonyforming units (CFU) was determined by serial dilution of the bacterial suspension on LB plates incubated at 37? C for 12–16 h followed by counting the number of viable colonies.

74 Results and discussion Construction of plant expression vector The hLF-SEKDEL fusion gene was inserted into the plant expression vector pPCV702E and the resulting vector was designated pPCV702EhLF (Figure 1). Plant expression vector pPCV702E contains the enhanced CaMV 35S promoter and was constructed by replacing the 35S promoter of pPCV702 vector with the enhanced CaMV 35S promoter fragment. A fragment of the 35S promoter extending between positions ?343 and ?9 in tandem order was found to enhance the level of promoter activity up to 100 fold (Kay et al., 1987). The enhanced CaMV promoter was constructed by ampli?cation of the original CaMV 35S promoter from plasmid pPCV702 with two primers (primer 1, 5 -TCATCGCAAGACCGGCAACAG; primer 2, 5 CCGGAATTCCGGTTTAAATTGAGACTTTTCAACAAAGGG) as a BamH I and EcoR I fragment. The ampli?ed DNA fragment was subcloned into the same sites of a pBlueScript vector to make pBS35S. The enhancer region of the 35S promoter (nucleotides ?343 to ?90) excised from pBS35S as an EcoR V and EcoR I fragment, was blunt-ended with DNA polymerase I (Klenow fragment), and inserted into the EcoR V site of pBS35S. The intermediate plasmid containing the tandem repeats of the enhancing 35S promoter element was named pBS35SE. The enhanced tandem 35S promoter was excised from pBS35SE as a BamH I-EcoR I fragment and ligated in place of the 35S promoter in plasmid pPCV702 to make plant expression vector pPCV702E. The hLF-SEKDEL fragment was inserted downstream of the mas P2 promoter in plasmid pPCV701 resulting in vector pPCV701hLF (Figure 1). The mas dual promoters have either low or no detectable activity during plant vegetative growth, while the CaMV 35SE promoter is constitutively expressed in transgenic plant cells. The mas promoter is activated to the same or even higher levels of expression than the CaMV 35SE promoter by incubation of the transformed plant tissues in auxin. Plant expression vectors pPCV702EhLF and pPCV701hLF harboring the 2154 bp LF:SEKDEL fusion gene contain in addition the β-lactamase (Bla) gene which confers ampicillin resistance in E. coli and carbenicillin resistance in A. tumefaciens. The neomycin phosphotransferase II gene (NPT II) linked to the nopaline synthase (NOS) promoter provides antibiotic selection for transformed plant cells. An oligonucleotide sequence encoding the SEKDEL microsomal retention signal in a codon usage favored by potato, was inserted at the 3 end of the coding sequence of the hLF gene to facilitate accumulation of hLF protein within the lumen of ER. Detection of transformed plants Putative transformed potato plants were regenerated on MS medium containing 50 mg/l kanamycin. Eight independent kanamycin-resistant potato plants were obtained after transformation with pPCV702EhLF and three antibiotic resistant plants were obtained after transformation with pPCV701hLF. The presence of the hLE:SEKDEL sequence in the genomic DNA isolated from leaf and tuber tissues of regenerated potato plants was detected by PCR ampli?cation method. All 11 putative transformants were found to contain the hLF:SEKDEL insert. The products of PCR ampli?cation of genomic DNA from selected transformed potato plants are shown in Figure 2. The expected PCR product was a 2217 base pair hLF cDNA. The same DNA fragment was ampli?ed when plasmids pPCV702EhLF and pPCV701hLF were used as templates. Potato plants transformed with the parent vectors pPCV702E and pPCV701 did not contain the hLF:SEKDEL insert. Expression of the hLF:SEKDEL gene fusion in transgenic potatoes Transgenic plants containing hLF cDNA were screened for expression of recombinant lactoferrin:SEKDEL gene fusion by indirect enzyme linked immunosorbent assay (ELISA) methods. Total protein was extracted from both leaf and tuber tissues from eight potato plants transformed with pPCV702EhLF. In addition, leaf explants and tuber slices from three pPCV701hLF-transformed plants were incubated on MS plates containing 5 mg/l NAA and 6 mg/l 2,4D for 5 days to achieve maximum activation of the mas promoter. Total soluble protein was extracted and quanti?ed by the Bradford protein assay (Bradford, 1976). The results of indirect ELISA experiments showed that all of the transgenic plants expressed variable levels of the hLE:SEKDEL fusion protein in leaf and tuber tissue. The amounts of lactoferrin detected varied from 0.01% of total soluble protein for auxin induced pPCV701hLF-transformed plant tubers to 0.1% of total soluble protein for pPCV702hLF-transformed plants. The ELISA results were further con?rmed by subjecting the plant extracts to immunoblot analysis.

75

Figure 3. Immunodetection of human lactoferrin protein synthesized in tubers of transgenic potato plants. Total soluble protein (100 ?g or 150 ?g /lane) from potato tubers was fractionated by SDS-PAGE, blotted onto a nitrocellulose membrane, and probed with a rabbit anti-human lactoferrin primary antibody and detected with alkaline phosphatase conjugated goat anti-rabbit secondary antibody. Plant-produced lactoferrin migrates as a single band with a identical mobility to human lactoferrin with an estimated molecular mass of approximately 80 kDa. Lane1 is 100-ng human lactoferrin puri?ed from human milk. Lanes 2 and 5 are cell extracts from an untransformed plant. Lane 7 (100 ?g protein) and lane 4 (150 ?g protein) are tuber cell extracts from the auxin induced #3 plant transformed with pPCV701hLF. Lane 3 (100 ?g protein) and lane 6 (150 ?g protein) are tuber cell extracts from the #8 plant transformed with pPCV702EhLF.

Figure 2. PCR detection of the human lactoferrin-SEKDEL fusion gene in transgenic potato leaf tissues. The predicted PCR DNA fragment is 2217 bp containing the entire hLE:SEKDEL gene and two ?anking primers. Lane 1 is the PCR product ampli?ed from plasmid pPCV702EhLF:SEKDEL; lane 2 is untransformed negative control plant leaf tissues; lane 3 is the #8 transformant of pPCV702EhLF transgenic plants and lane 4 is the #3 transgenic plant of pPCV701hLF. Lane M is the 1-kb DNA molecular size marker ladder.

Approximately 100 ?g protein extract was loaded on a 10% SDS-PAGE gel and electrophoretically transferred to a nitrocellulose membrane for immunoblotting. All 11 transformed plants were found to express hLF proteins with identical molecular mass measurements. Recombinant lactoferrin protein synthesized in several transgenic plants is shown in Figure 3. The plant-produced lactoferrin proteins (lane 3, 4, 6, and 7) migrated as a single band in the SDS-PAGE gel with a molecular weight of approximately 80 kDa, which was equivalent to the full length commercial hLF protein (lane 1). Untransformed plant protein extract did not react with the anti-lactoferrin antibody (lane 2 and 5). Amounts of hLF protein synthesized among plants transformed with the two vectors differed signi?cantly. In agreement with the ELISA quanti?cation experiments, the immunoblot results indicated that approximately 0.01% of total soluble pro-

tein was recombinant lactoferrin in pPCV702EhLEtransformed plant tubers and 0.1% hLF from auxin induced pPCV701hLF-transgenic plant tubers. Lactoferrin expression in potato plants from the auxin induced mas P2 promoter (Figure 3, lane 4 and 7) in potato plants was approximately10-fold higher than the amount of lactoferrin generated by the enhanced CaMV 35S promoter (Figure 3, lane 3 and 6). The lactoferrin:SEKDEL gene expressed in transgenic potato plants contained 2154 bp of coding sequence. The predicted amino acid sequence of recombinant lactoferrin protein plus its native 19 amino acid leader sequence and 6 amino acid residue ER retention signal (SEKDEL) was 717 amino acids. Puri?ed mature lactoferrin protein from human milk contains 692 amino acids and has a molecular weight around 80 kDa based on SDS-PAGE (Giugliano et al., 1995). The electrophoretic mobility of plant produced lactoferrin fusion protein on SDS-PAGE gels was approximately equal to commercial lactoferrin. Although it is presently unknown whether the leader sequence of lactoferrin is correctly processed in plants, molecular weight estimates indicate that it is likely that fulllength lactoferrin protein is synthesized in transgenic potato plants. In previous experiments, Mitra and Zhang (1994) reported expression of hLF in tobacco calli. However, only a truncated lactoferrin protein with a molecular weight of 48 kDa was produced. Recently, recombinant hLF was isolated from transgenic tobacco cells with a molecular mass similar to the native protein (Salmon et al., 1998). Analysis of

76
Table 1. Antibacterial activity of protein extracts from transgenic potato tubers expressing a human lactoferrin:SEKDEL fusion gene. Data represent the average of three experiments Strain Control plant (Vector only) Escherichia coli (Migula) Staphylococcus aureus Salmonella paratyphi Escherichia coli (DH5α) 3.5 × 108 3.7 × 108 6.3 × 107 1.7 × 108 Lactoferrin (Commercial) 2.8 × 108 2.9 × 108 6.4 × 107 1.8 × 108 CFU/ml Transgenic plant (pPCV701hLF) 4.0 × 106 4.2 × 108 ? 3.0 × 105 3.7 × 105
? ?

Transgenic plant (pPCV702EhLF) 2.4 × 108 4.6 × 108 6.9 × 107 7.1 × 105

?

Asterisks (? ) indicate signi?cant differences from untransformed plant extracts (p ≤ 0.05) as determined by Students’ t-test. CFU: colony forming units.

the puri?ed recombinant lactoferrin for glycosylation indicated that consistent with plant post-translational modi?cation patterns, xylose was present and sialic acid was absent. Similarities in the molecular mobility pattern indicate that full-length lactoferrin protein synthesized in potatoes may be correctly processed. Antibacterial effect of plant extracts containing hLF Native lactoferrin inhibits the growth of a variety of bacterial species based on its iron chelation and additional direct bacteriocidal properties. To more accurately determine the biological activity of potato synthesized hLF, we tested the anti-microbial effects of plant produced hLF from tuber cell extracts without concentration or further puri?cation. The antibacterial effects of plant-produced lactoferrin are shown in Table 1. Among four bacterial strains tested, three (Escherichia coli (Migula) (ATCC 35218), Escherichia coli (DH5α), and Salmonella paratyphi) demonstrated a reduction in colony growth mediated by cell extracts of transgenic potato plants. However, growth of Staphylococcus aureus (ATCC 29213) appeared to be enhanced. This result is consistent with a previous observation of Staphylococcus aureus resistance to lactoferrin (Arnold et al., 1980) and con?rms the biological activity of lactoferrin produced in potato plants. It was observed that plants with higher levels of lactoferrin expression exhibited stronger antibacterial effects. For example, plants transformed with pPCV701hLF signi?cantly reduced the number of colony forming units on all three lactoferrin-sensitive bacterial strains, while extracts of transformed tubers containing pPCV702EhLF signi?cantly inhibited only the growth of the E. coli (DH5α) strain (Table 1). Incubation of the bacteria with a high amount (500 ?g)

of puri?ed commercial hLF did not generate a signi?cant antibacterial effect. When 0.1 mM FeSO4 was used to supplement the medium, the antibacterial activity of transgenic plant cell-extracts on E. coli (DH5α) was signi?cantly reduced but not completely eliminated indicating that the plant produced lactoferrin bacteriocidal effect may be based predominantly on its iron chelating effect with a smaller anti-microbial component based on an alternative mechanism. Mitra and Zhang (1994) reported that a truncated 48-kDa peptide of lactoferrin produced in transgenic tobacco calli signi?cantly reduced the growth of four plant pathogenic bacterial strains. We observed a smaller reduction in bacterial growth mediated by full-length potato-synthesized lactoferrin. The smaller amounts of recombinant lactoferrin present in our cell extracts may have contributed to the lower levels of antibacterial activity that we detected. Mitra and Zhang (1994) detected approximately 1.8% lactoferrin in the extract prepared from tobacco calli. In our experiments, in addition to production of lactoferrin in a different plant species (potato), we estimated that the lactoferrin produced in tuber cell extracts from pPCV702EhLF-trangenic plants was approximately 0.01% of total soluble protein or 0.1% of total soluble protein in extracts from auxin induced pPCV701hLFtransformed tissues. Tuber extracts containing more lactoferrin showed consistently stronger antimicrobial effects. In contrast to Mitra and Zhang’s results, our experimental data indicate that genetically engineered potato plants produce a full-length form of hLF, which retains its biological activity based on immunoblot detection and bacteriostatic or bacteriocidal effects against a variety of human pathogenic bac-

77 terial strains. The results obtained for expression of human milk lactoferrin in potato complements the results from our earlier experiments demonstrating the expression of human milk β-casein in edible plants (Chong et al., 1997). The addition of genes encoding human milk proteins such as β-casein and lactoferrin in potato opens the way for addition of a variety of plant-synthesized hypoallergenic human milk proteins to infant formulas and baby foods for enhanced digestibility and increased nutritional content for promotion of growth and protection of neonates and young children against infectious diseases and the development of food allergies leading to auto-immune disease in later life.
Chong DK, Roberts W, Arakawa T, Illes K, Bagi G, Slattery CW and Langridge WH (1997) Expression of the human milk protein beta-casein in transgenic potato plants. Transgenic Res 6: 289– 296. Furmanski P, Li ZP, Fortuna MB, Swamy CV and Das MR (1989) Multiple molecular forms of human lactoferrin. Identi?cation of a class of lactoferrins that possess ribonuclease activity and lack iron-binding capacity. J Exp Med 170: 415–429. Giugliano LG, Ribeiro ST, Vainstein MH and Ulhoa CJ (1995) Free secretory component and lactoferrin of human milk inhibit the adhesion of enterotoxigenic Escherichia coli. J Med Microbiol 42: 3–9. Hashizume S, Kuroda K and Murakami H (1983) Identi?cation of lactoferrin as an essential growth factor for human lymphocytic cell lines in serum-free medium. Biochim Biophys Acta 763: 377–382. Kay R, Chen A, Daly M and McPherson J (1987) Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236: 1299–1302. Legrand D, Mazurier J, Metz-Boutigue MH, Jolles J, Jolles P, Montreuil J and Spik G (1984) Characterization and localization of an iron-binding 18-kDa glycopeptide isolated from the Nterminal half of human lactotransferrin. Biochim Biophys Acta 787: 90–96. Liang Q and Richardson T (1993) Expression and characterization of human lactoferrin in yeast Saccharomyces cerevisiae. J Agric Food Chem 41: 1800–1807. Masson PL, Heremans JF and Ferin J (1968) Presence of an ironbinding protein (lactoferrin) in the genital tract of the human female. I. Its immunohistochemical localization in the endometrium. Fertil Steril 19: 679–689. Mitra A and Zhang Z (1994) Expression of a human lactoferrin cDNA in tobacco cells produces antibacterial protein(s). Plant Physiol 106: 977–981. Nuijens JH, van Berkel PH, Geerts ME, Hartevelt PP, de Boer HA, van Veen HA, and Pieper FR (1997) Characterization of recombinant human lactoferrin secreted in milk of transgenic mice. J Biol Chem 272: 8802–8807. Odell JT, Nagy F and Chua NH (1985) Identi?cation of DNA sequences required for activity of the cauli?ower mosaic virus 35S promoter. Nature 313: 810–812. Oseas R, Yang HH, Baehner RL and Boxer LA (1981) Lactoferrin: a promoter of polymorphonuclear leukocyte adhesiveness. Blood 57: 939–945. Platenburg GJ, Kootwijk EP, Kooiman PM, Woloshuk SL, Nuijens JH, Krimpenfort PJ, Pieper FR, de Boer HA and Strijker R (1994) Expression of human lactoferrin in milk of transgenic mice. Transgenic. Res. 3: 99–108. Saito H, Miyakawa H, Tamura Y, Shimamura S and Tomita M (1991) Potent bacteriocidal activity of bovine lactoferrin hydrolysate produced by heat treatment at acidic pH. J Dairy Sci 74: 3724–3730. Salmon V, Legrand D, Slomianny MC, el Yazidi I, Spik G, Gruber V, Bournat P, Olagnier B, Mison D, Theisen M and Merot B (1998) Production of human lactoferrin in transgenic tobacco plants. Protein Expr Purif 13: 127–135. Spik G, Strecker G, Fournet B, Bouquelet S, Montreuil J, Dorland L, van Halbeek H and Vliegenthart JF (1982) Primary structure of the glycans from human lactotransferrin. Eur J Biochem 121: 413–419. Stowell KM, Rado TA, Funk WD and Tweedie JW (1991) Expression of cloned human lactoferrin in baby-hamster kidney cells. Biochem J 276: 349–355.

Acknowledgements We would like to thank Dr. Orla M. Conneely at Baylor College of Medicine, Houston, Texas for providing the hLF cDNA used in our cloning and plant transformation experiments. This work was supported by a Basic Science Research Grant provided to Dr. W.H.R. Langridge from the Loma Linda University, School of Medicine.

References
Anderson BF, Baker HM, Norris GE, Rice DW and Baker EN (1989) Structure of human lactoferrin: crystallographic structure analysis and re?nement at 2.8 ? resolution. J Mol Biol 209: 711–734. Arnold RR, Brewer M and Gauthier JJ (1980) Bacteriocidal activity of human lactoferrin: sensitivity of a variety of microorganisms. Infect Immun 28: 893–898. Arnold RR, Russell JE, Champion WJ and Gauthier JJ (1981) Bacteriocidal activity of human lactoferrin: in?uence of physical conditions and metabolic state of the target microorganism. Infect Immun 32: 655–660. Bellamy W, Takase M, Yamauchi K, Wakabayashi H, Kawase K and Tomita M (1992) Identi?cation of the bacteriocidal domain of lactoferrin. Biochim Biophys Acta 1121: 130–136. Bennett RM and Davis J (1982) Lactoferrin interacts with deoxyribonucleic acid: a preferential reactivity with doublestranded DNA and dissociation of DNA-anti-DNA complexes. J Lab Clin Med 99: 127–138. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254. Broxmeyer HE, Mantel C, Gentile P, Srivastava C, Miyazawa K, Zucali JR, Rado TA, Levi S and Arosio P (1991) Actions of H-subunit ferritin and lactoferrin as suppressor molecules of myelopoiesis in vitro and in vivo. Curr Stud Hematol Blood Transfus 178–181.

78
van Berkel PH, Geerts ME, van Veen HA, Kooiman PM, Pieper FR, de Boer HA and Nuijens JH (1995) Glycosylated and unglycosylated human lactoferrins both bind iron and show identical af?nities towards human lysozyme and bacterial lipopolysaccharide, but differ in their susceptibilities towards tryptic proteolysis. Biochem J 312: 107–114. Velten J, Velten L and Schell J (1984) Isolation of a dual plant promoter fragment from the Ti plasmid of Agrobacterium tumefaciens. EMBO J 3: 2723–2730. Ward PP, May GS, Headon DR and Conneely OM (1992) An inducible expression system for the production of human lactoferrin in Aspergillus nidulans. Gene 122: 219–223.


相关文章:
更多相关标签: