当前位置:首页 >> 农林牧渔 >>

Expression patterns of keratin intermediate filament and keratin associated protein genes in wool fo


ARTICLE IN PRESS
Differentiation 77 (2009) 307–316

Contents lists available at ScienceDirect

Differentiation
journal homepage: www.elsevier.com/locate/diff

/>
Expression patterns of keratin intermediate ?lament and keratin associated protein genes in wool follicles
Zhidong Yu a,?, Steven W. Gordon a, Allan J. Nixon a, C. Simon Bawden b, Michael A. Rogers c, Janet E. Wildermoth a, Nauman J. Maqbool d, Allan J. Pearson a
a

Growth and Development Section, AgResearch Ruakura, Private Bag 3123, Hamilton 3214, New Zealand SARDI Livestock Systems, Roseworthy Campus, Roseworthy, SA 5371, Australia c Division of Cell Biology, German Cancer Research Centre, 69120 Heidelberg, Germany d Bioinformatics, Mathematics and Statistics Section, AgResearch Invermay, Private Bag 50034, Mosgiel 9074, New Zealand
b

a r t i c l e in fo
Article history: Received 14 March 2008 Received in revised form 17 September 2008 Accepted 3 October 2008 Keywords: Brush-end Fibre curvature Gene expression Growth cycle Hair follicle Sheep

abstract
The catalogue of hair keratin intermediate ?laments (KIFs) and keratin-associated proteins (KAPs) present in wool follicles is incomplete. The full coding sequences for three novel sheep KIFs (KRT27, KRT35 and KRT38) and one KAP (KRTAP4-3) were established in this study. Spatial expression patterns of these and other genes (KRT31, KRT85, KRTAP6-1 and trichohyalin) were determined by in situ hybridisation in wool follicles at synchronised stages of growth. Transcription proceeded in the order: trichohyalin, KRT27, KRT85, KRT35, KRT31, KRT38, KRTAP6-1 and KRTAP4-3, as determined by increasing distance of their expression zones from the germinal matrix in anagen follicles. Expression became gradually more restricted to the lower follicle during follicle regression (catagen), and ceased during dormancy (telogen). Some genes (KRT27, KRT31, KRT85 and KRTAP6-1), but not others, were expressed in cortical cells forming the brush-end, indicating speci?c requirements for the formation of this anchoring structure. The resumption of keratin expression was observed only in later stages of follicle reactivation (proanagen). KIF expression patterns in primary wool follicles showed general resemblance to their human homologues but with some unique features. Consistent differences in localisation between primary and secondary wool follicles were observed. Asymmetrical expression of KRT27, KRT31, KRT35, KRT85 and trichohyalin genes in secondary follicles were associated with bulb de?ection and follicle curvature, suggesting a role in the determination of follicle and ?bre morphology. Crown Copyright & 2008 Published by Elsevier Ltd. on behalf of International Society of Differentiation All rights reserved.

1. Introduction A growing (anagen) hair follicle comprises nine concentric, cylindrical cell layers (Auber, 1951) (Fig. 1a). These layers differentiate from the germinal matrix (GM), a ring of rapidly dividing cells at the base of the bulb. The ?bre (or hair shaft) is composed of the hair cortex, with or without a medulla, encased in an outer cuticle. External to the hair shaft is the inner root sheath (IRS) consisting of three successive layers: the IRS cuticle, Huxley’s layer and Henle’s layer. The outer root sheath (ORS) surrounds the IRS and is continuous with the skin epidermis. The companion layer (CL) on the internal side of the ORS abuts Henle’s layer of the IRS. The dermal sheath surrounds the epithelial tissues of the follicle, and is continuous with the dermal papilla (DP), an inclusion of dermal cells at the centre of the bulb that has

? Corresponding author. Tel.: +64 7 8385604; fax: +64 7 8385536.

E-mail address: zhidong.yu@agresearch.co.nz (Z. Yu).

a critical role in controlling follicle growth through interactions with the GM. Keratinocytes migrate distally from the bulb towards the skin surface, and are characterised by the sequential expression of numerous genes encoding keratin intermediate ?laments (KIFs) and keratin-associated proteins (KAPs) (Powell et al., 1992; Rogers et al., 2000; Langbein et al., 1999, 2001; Rogers et al., 2004a). The co-ordinated expression of type I and type II KIF monomers, which consist of an N-terminal head domain, a central a-helical rod domain and a C-terminal tail domain (Powell, 1996; Powell and Rogers, 1997) leads to the formation of macro?brils. These macro?brils are embedded in an inter?lamentous matrix comprised predominantly of KAPs (Powell, 1996), together with trichohyalin (THL) in the IRS and medulla (Fietz et al., 1990) and other proteins in the epidermis (Lee et al., 1999). The spatial organisation of the KIFs and their chemical bonding with KAPs in the matrix are thought to largely determine the physical properties of the ?bre (Powell and Rogers, 1997). Compared with the rapid progress in characterising human KIF and KAP genes expressed in the cortex (Langbein and Schweizer, 2005;

0301-4681/$ - see front matter Crown Copyright & 2008 Published by Elsevier Ltd. on behalf of International Society of Differentiation All rights reserved. doi:10.1016/j.diff.2008.10.009

ARTICLE IN PRESS
308 Z. Yu et al. / Differentiation 77 (2009) 307–316

istic bulb de?ection (Fig. 1a). Hence, Wiltshire sheep represent a model for studying keratin gene expression both across follicle growth cycles (Nixon et al., 1999, 1997) and between follicle subpopulations. In this paper, we describe four novel sheep KIF cDNAs, a KAP genomic sequence and their predicted proteins. These, together with trichohyalin and other KIF and KAP genes, were selected for study on the basis of their diverse expression patterns in human hair (Langbein et al., 1999, 2001; Bawden et al., 2001) and wool follicles (Bawden et al., 2001; Fietz et al., 1990; Fratini et al., 1993, 1994). Novel features of their expression across the follicle growth cycle and in wool follicles of differing curvature are revealed and discussed.

2. Materials and methods 2.1. Skin sample collection Wool follicle growth was synchronised by housing 13 NZ Wiltshire sheep indoors under a short-day photoperiod for 4 months and then releasing them into long-day photoperiod (Pearson et al., 1996). Follicle growth activity was monitored in mid-side skin biopsies collected at 4–7 day intervals. Seven sheep were sacri?ced over 10 weeks, collecting skin from 17 different bodysites on each animal, to encompass a complete follicle growth cycle. Skin samples for RNA extraction were snap frozen in liquid nitrogen and stored at ?80 1C, while samples for histology and in situ hybridisation were ?xed in buffered 10% formalin for 48 h and processed to paraf?n wax using a standard overnight protocol (LEICA TP 1050, Nussloch, Germany). Follicle activities were determined by histomorphology in longitudinal and transverse Sacpic-stained sections (Nixon, 1993; Parry et al., 1995). 2.2. cDNA sequences of candidate genes cDNA skin libraries were derived from NZ Wiltshire sheep skin samples containing follicles in anagen, catagen, telogen or proanagen in addition to skin containing anagen follicles from Romney sheep. The libraries were randomly sequenced (MWG Biotech AG, Munich, Germany) and contigs assembled from the expressed sequence tags (ESTs) and other published ovine sequences (Keane et al., 2006). Additional sequence to complete the coding sequence (CDS) of KRT38 was derived using rapid ampli?cation of cDNA ends (RACE) (Invitrogen Life Technologies, Carlsbad, CA) with the nested primers: TGGCGAAGGCTTCTTCAACAG, ACCATGCAGTTCTTGAATGACCG and GCATCCGAGAGCTGAGCAAAT. The cDNA and translated proteins were compared to the human sequences using the AlignX module of Vector NTI v9 (Invitrogen) for determining the identity of selected contigs. The recently proposed human KIF naming system (Schweizer et al., 2006) was adopted for this study (Table 1). The sequence for the KRTAP4-3 gene (EU239778) was originally isolated as part of a Lambda clone from an EMBL3 sheep genomic DNA library (Clontech, Sydney, Australia). The entire gene contained within a 2.3 kb EcoRI fragment was sequenced, then assembled and analysed using the ANALYSEQ program (Staden, 1984). The cDNA sequences of KRTAP6-1 (M95719.1) and TCHH (X51695) were obtained from Genbank. 2.3. In situ hybridisation with digoxigenin-labelled probes (DISH) Sequences of in situ probes were ampli?ed by PCR using primers targeting within or close to the 30 untranslated region

Fig. 1. Schematic wool follicle structures at anagen (a) and telogen (b). (a) Schematic diagram of a growing (anagen) secondary follicle and its associated skin appendages showing the cylindrical cell layers, bulb, keratogenous and ?nal hardening zones. (b) Diagram of the proximal end of a late catagen/telogen follicle showing the brush-end. BE, brush-end; CL, companion layer; CO, cortex; DP, dermal papilla; FC, ?bre cuticle; GM, germinal matrix; IRS, inner root sheath; ORS, outer root sheath.

Rogers et al., 2006, 2007) and in the IRS (Langbein et al., 2002, 2003), our knowledge of wool follicle structural genes and their expression is incomplete, re?ecting the availability of limited ovine genomic sequence. The wool cortex comprises different cell types: the ortho-, meso- and para-cortex (Mercer, 1953; Horio and Kondo, 1953; Kaplin and Whiteley, 1978). Each cell type is characterised by a distinctive macro?bril orientation and packing (Rogers, 1959; Caldwell et al., 2005). In curved or crimped wool ?bres, the orthocortex is typically found on the outer (ectal) side of the curve and the paracortex on the inner (ental) side (Fraser and Rogers, 1955). While the ability to study changes in KIF and KAP expression with follicle growth status is limited by the long period of continuous follicle growth in humans and most sheep breeds, the seasonal cycle of wool growth in New Zealand Wiltshire sheep can be synchronised by photoperiod manipulation enabling the collection of follicles in discrete growth stages ranging between anagen and telogen (Fig. 1b) (Pearson et al., 1996). The relatively straight, coarse and medullated primary follicles in Wiltshire sheep are easily distinguished from the ?ner, curved and non-medullated secondary follicles with a character-

ARTICLE IN PRESS
Z. Yu et al. / Differentiation 77 (2009) 307–316 309

Table 1 Revised and previous nomenclatures for sheep KIF genes. Sheep Revised namesa Type I I I I II II II II Ih (IRS) I (IRS) I (IRS) I (IRS) Gene KRT31 KRT33A KRT35 KRT38 KRT81 KRT83 KRT85 KRT86 KRT25 KRT26 KRT27 KRT28 Protein K31 K33a K35 K38 K81 K83 K85 K86 K25 K26 K27 K28 Previous nomenclatureb Gene KRT1.1 KRT1.2d
c

Human New sequence Accession no.
c

Previous nomenclature Gene KRTHA1 KRTHA3A KRTHA5 KRTHA8 KRTHB1 KRTHB3 KRTHB5 KRTHB6 KRT25A KRT25B KRT25C KRT25D Protein Ha1 Ha3-I Ha5 Ha8 Hb1 Hb3 Hb5 Hb6 K25irs1i/hIRSa1 K25irs2j K25irs3j/hIRSa3.1 K25irs4j/hIRSa2

Protein K1.1 (8c1 ) K1.2 (partial)

EU216425 EU216426 EU216427

KRT2.9b KRT2.10e KRT2.12f KRT2.11g oIRSa1i oIRSa2i oIRSa3.1i oIRSa3.2i

K2.9 K2.10 (7c) K2.12 (component 5) K2.11 (partial) oIRSa1 oIRSa2 (partial) oIRSa3.1 (partial) oIRSa3.2 (partial)

EU216428

EU216424

Genes in BOLD were investigated in this study. a Schweizer et al. (2006). b Powell et al. (1992). c Dowling et al. (1986). d Wilson et al. (1988). e Sparrow et al. (1989). f Sparrow et al. (1992). g Powell and Beltrame (1994), Powell et al. (1992). h No ovine type II IRS KIF has been reported. i Bawden et al. (2001). j Rogers et al. (2004b).

Table 2 PCR primers for cloning the DISH probe for each gene. Gene KRT27 KRT31 KRT35 KRT38 KRT85 KRTAP4-3 KRTAP6-1 TCHH Forward primer ctgtcatctagagttcacactgtggaa acagcgaggactgcaagc aagccaaggccattgtatcca ctgggtcctgctcatc acct gaaaactcagcctgcctctg (See Material and methods) ctactattgaggatgccacgaa gcttcgagcaaaggaaaatg Reverse primer tttgggctcaggaaggca aaccactgggactctagc aaaacctgacccaggaggca gagtggctggaccagaaagc gaggagtttggctggaacag Probe size (bp)

88 174 241 191 221 180 aagtcttctgcatggaagtcaaa 137 caaatctgcaccaaagagca 187

NBT/BCIP (Roche). When colour development was optimal the substrates were removed by washing. Finally the slides were counterstained with either 0.2% eosin or 0.1% nuclear fast red prior to mounting. In order to visualise the mRNA signal in multiple primary and secondary follicles between 20 and 40 sections were hybridised with antisense probe for each gene. All images were recorded using an Olympus BX50 microscope equipped with a SpotTM RT CCD camera (RT Slider Diagnostic Instrument Inc., Sterling Height, MI) and imported into PhotoShop (Corel Minneapolis, MS) for editing. 2.4. Janus Green staining Adjacent 8 mm transverse sections from mid-side sites were used to investigate the relationship between cortical segmentation (Janus Green stains paracortex) and the expression of KRT31, KRT35, KRT38, KRTAP4-3 and KRTAP6-1. Sections were oxidised in fresh performic acid for 1 h, rinsed in water, stained in 0.1% Janus Green (Sigma, St. Louis, MO) for 45 min, rinsed in water and decolourised in 10% acetic acid for 15 min. The slides were mounted after counterstaining with 0.2% eosin (Fraser and Rogers, 1954).

(UTR) of each gene and cloned into pGEM-T (Promega, Madison, WI) (Table 2). After con?rming identities by sequencing, the plasmids were linearised for the synthesis of sense or antisense (complementary) RNA probes by SP6 or T7 RNA polymerase in the presence of a digoxigenin-labelled NTP mix (Roche Diagnostics GmbH, Mannheim, Germany). For KRTAP4-3, a 180 bp BanII/EcoRI fragment ?anked by GAGCCCATGTTCTAA and TCTGACACAGAATTC in the 30 UTR was cloned into the SmaI site of pGEM7Zf(+) for making probes. The working concentration for each probe was determined by testing dilutions between 1:200 and 1:2400. Hybridisation of probes on 8 mm paraf?n-embedded skin sections was conducted as previously described (Miller et al., 1993). Brie?y, after dewaxing and rehydration the sections were treated with proteinase K, followed by acetylation using triethanolaminebuffered acetic anhydride solution. After the addition of probes in hybridisation buffer (0.15 M NaCl, 50% formamide, 2 ? SSC, 0.2 mg/ml tRNA, 1 mg/ml degraded herring DNA, 0.4 mg/ml BSA and 11.5% Dextran SO4), the slides were incubated at 65 1C overnight in a sealed humidity box, followed by washing and treatment with RNase A (0.02 mg/ml) and RNase T1 (5 units/ml) (Sigma, St. Louis, MD). After blocking, the sections were incubated with an alkaline phosphatase-linked Fab fragment of sheep antibody to digoxigenin (Roche). The sections were then washed and incubated under coverslips in 10% PVA buffer containing the

3. Results 3.1. Induced follicle growth cycle The short-to-long day photoperiod transition induced follicle growth regression in the NZ Wiltshire sheep, which commenced on the ventral surface and progressed dorsally. Most follicles were in telogen 3 weeks later and, within the course of the next 5 weeks follicles had reactivated into a new anagen phase (data not shown). Skin samples from the mid-side, lower side, underside, face and legs, containing follicles in differing cycling stages and

ARTICLE IN PRESS
310 Z. Yu et al. / Differentiation 77 (2009) 307–316

Table 3 Follicle and ?bre characteristics and follicle cycle stages in skin samples used for DISH. Bodysite Mid-side Mid-side Belly Lower-side Face Leg
a

S/P ratioa 3.8 3.8 3.2 3.7 0.3 1.0

Fibre size (mm2) 28.5 28.5 30.8 30.7 75.7 69.5

% Medullationb 21 21 25 25 68 61

Cycle stage Anagen Late catagen Telogen Proanagen Asynchronouse Asynchronouse

Ac 100d 0 0 0 57 38

C 0 25 0 0 9 0

T 0 61 82 63 26 17

PII 0 14 9 38 4 28

PIII 0 0 9 0 4 17

Ratio of secondary to primary follicles. Fibre diameter and % medullation are means of fore and hind leg values reported previously (Craven et al., 2007). A, C, T, PII and PIII represent anagen, catagen, telogen, proanagen II and proanagen III stages of the follicle growth cycle respectively according to the previous classi?cation, respectively (Nixon, 1993). d Percentages of follicles in each cycle stage. e Follicles on the face, and to some extent on the lower leg, exhibit a reduced response, thus unsynchronisation, to photoperiod than other bodysites (unpublished data).
b c

secondary to primary (S/P) follicle ratios, were selected for comparison of expression localisation (Table 3). 3.1. Novel sheep KIF and KAP cDNA sequences KRT27: A sheep cDNA contig had 87.9% sequence homology to human KRT27. The complete CDS de?ned a protein of 460 amino acid residues, including the previously reported 101 C-terminal residues (Bawden et al., 2001), and with high similarity to the 459 amino acids of human K27. The rod domains of the sheep and human orthologues shared 95.6% of their residues, while the overall identity was 92.0%. It had low cysteine content (2.17%), particularly in the head and tail domains (3/84 and 0/61 residues, respectively), but was rich in glycine (8.91%). KRT35: The 1771 bp contig of the sheep cDNA had 81% homology to human KRT35, but lacked a complete 30 UTR. The CDS encoded a full 455 residue protein closely matching human K35 of the same size (NM_002280.3) in the head, rod and tail domains (80.4%, 90.7% and 85.1% identity, respectively) with an overall identity of 87.9%. KRT38: Assembly of a 1.4 kb RACE product with the EST contig resulted in a 1708 bp sequence similar to the mRNA size detected by northern blot hybridisation (NBH) in sheep skin. The encoded 453 residue protein showed lower homology (74.2%) relative to the human K38 of 456 residues. This was particularly evident in the head and the tail domains with 66.3% and 36.0% identity, respectively. KRTAP4-3: The genomic clone for this third member of the ovine ultra-high sulphur KAP4 family was 2749 bp in length and contained only one exon. Transcription was predicted to terminate 27 nucleotides from the end of the AATAAA motif (EU239778), thus generating mRNA concordant with the predominant 1.6 kb message in NBH. The gene predicted a 311 amino acid protein (KAP4.3) with high homology to KAP4.1 and KAP4.2 at the N- and C-termini. However, KAP4.3 was characterised by a longer central cysteine- and serine-rich sequence than oKAP4.2 (Powell and Rogers, 1997), which, in turn, was longer in this region than KAP4.1 (X73462.1) and members of human KAP4 family. 3.2. Localisation of KIF and KAP gene expression KRT85 expression was ?rst discernable in the ?bre cuticle and cortical cells in the lower bulb of primary follicles (Fig. 2a and a0 ). A strong, relatively symmetrical signal continued into the upper keratogenous zone, where expression in the two layers terminated simultaneously. In curved secondary follicles, earlier and stronger expression of KRT85 was consistently observed in the cortex on

the inner side of the bulb de?ection. While the central expression region above the bulb resumed symmetrical expression (Fig. 2b and c lower), asymmetry occurred again in the distal expression site (Fig. 2b and c upper). During follicle regression, the presence of KRT85 mRNA became progressively restricted to the lower (proximal) portion of the follicle. By late catagen, signal was only seen in cortical cells forming the ?bre brush-end (Fig. 2d and e), and had completely disappeared in telogen (not shown). No signal was detected in reactivating follicles during early proanagen, but expression became strong by mid-to-late proanagen. Serial transverse sections revealed that mRNA was present in scattered cells at both the distal (Fig. 2f) and the proximal (Fig. 2g and g0 ) margins of the expression zone, a feature shared by other cortical genes examined in this study. KRT35 expression was also localised to the cortical and cuticle cells in the lower bulb (Fig. 3a and b). In the ?bre cuticle, expression peaked around the line of Auber (widest part of DP) and continued into the lower keratogenous zone. However, KRT35 mRNA was restricted to a narrow zone in the precortex (Fig. 3a). In secondary follicles, asymmetrical expression in both the cortex and the ?bre cuticle was evident in a manner similar to that of KRT85 (Fig. 3b–d). However, no expression of KRT35 in the brushend-forming keratinocytes in late catagen follicles was observed. KRT31 expression was initially detected in spherical precortical cells above the line of Auber (Fig. 3e and f). More distally KRT31expressing cells were spindle-like and had lost their nuclei. Primary follicles with either symmetrical (Fig. 3e and h) or asymmetrical (Fig. 3f and g) expression were present. In contrast, asymmetry in both the proximal and the distal regions of secondary follicles was universal (Fig. 3i). The decline of KRT31 expression during catagen and its association with brush-end formation were similar to KRT85 (Fig. 3j). KRT38 mRNA was initially detected in a similar proximal location as for KRT31, though its expression zone was shorter. A mosaic pattern of expression was seen in the most proximal cortical cells, which were in transition from a spherical to elongated shape, but more distally became progressively ?attened and enucleated (Fig. 3k). Strikingly, all KRT38-expressing cells were on one side of the cortex (Fig. 3k and l) in both follicle populations, but restricted to a small number of cortical cells in many secondary follicles (Fig. 3m and n). KRTAP4-3 was symmetrically expressed in the cortex of the primary follicles (Fig. 4a). A striated appearance was observed due to interspersed cortical cells of high, low or no signal (Fig. 4a0 ). In common with KRT31 (Fig. 3f) and KRT85 (Fig. 2a00 ), its expression was also seen in cortical cells protruding into the medulla, but not in the medullary cells themselves (Fig. 4a0 ). In secondary follicles,

ARTICLE IN PRESS
Z. Yu et al. / Differentiation 77 (2009) 307–316 311

Fig. 2. Localisation of KRT85 mRNA in wool follicles. (a) KRT85 expression (blue) in an anagen primary follicle with enlargements a0 and a00 showing detail of the proximal and distal expression regions, respectively; (b) asymmetrical expression in a longitudinally sectioned secondary follicle; (c) KRT85 expression in distal (upper) and proximal (lower) secondary follicles in a transverse skin section; (d) and (e) expression in the brush-end-forming cortical cells of late catagen follicles; (f) and (g) DISH signal in the most distal (f) and proximal (g) regions with enlargement of the boxed area (g0 ); arrowheads in a00 indicate expression in cortical cells protruding into the medulla. (c), (e) and (f) are counterstained with eosin; others with nuclear fast red. MD, medulla; SHG, secondary hair germ; other abbreviations as in Fig. 1. Bars indicate 50 mm.

Fig. 3. Localisation of KRT35, KRT31 and KRT38 mRNA in wool follicles. KRT35 expression in longitudinal (a) and transverse (b) sections of anagen primary follicles and longitudinal sections of two anagen secondary follicles (c and d); KRT31 expression in longitudinal (e and f) and transverse (g and h) sections of primary follicles; longitudinal secondary follicles (i) and in the brush-end of a late catagen follicle (j); KRT38 expression in longitudinal (k) and transverse (l) sections of primary follicles and longitudinal (m) and transverse (n) sections of secondary follicles. Arrows in (a) and (c) point to the more distal expression in the ?bre cuticle. Arrowheads in f as in Fig. 2a and 4a. (b), (e), (f), (h) and (l) are counterstained with nuclear fast red; others with eosin. Bars indicate 50 mm.

ARTICLE IN PRESS
312 Z. Yu et al. / Differentiation 77 (2009) 307–316

Fig. 4. Localisation of KRTAP4-3 and KRTAP6-1 mRNA in wool follicles. KRTAP4-3 expression in the cortex of a primary anagen follicle (a) with enlargement of the striated pattern (a0 ), and in longitudinal (b) and transverse (c) sections of secondary follicles. KRTAP6-1 expression in longitudinal (d, e and f) and transverse sections (g, h and k) of primary anagen follicles; in longitudinal (i) and transverse (j) sections of secondary follicles, and in the brush-end-forming cortex in late catagen (l) with enlargement (l0 ). Arrowheads in a0 point to expression in cortical cells protruding into the medulla. Arrows in (c) and (j) point to the most distal expression region and the block arrow in l indicates the breakdown of IRS. (a), (b), (c) and (j) are counterstained with eosin; others with nuclear fast red. Bars indicate 50 mm.

KRTAP4-3 mRNA was detected in approximately half of the cortex in the central expression zone (Fig. 4b and c), but restricted to only a few cells at the distal margin (Fig. 4c). KRTAP6-1 expression in primary follicles varied from isolated cortical cells (Fig. 4d–f) to half (Fig. 4d–g) or the entire (Fig. 4h) cortex. In curved secondary follicles, however, its mRNA was consistently restricted to cells on one side of the cortex (Fig. 4i–j). During follicle shutdown, KRTAP6-1 expression was strong in cortical cells forming the brush-end (Fig. 4l and l0 ), but terminated when follicles entered telogen. KRT27 expression commenced in IRS cells close to the base of the bulb in the external layer and continued through to the ?nal hardening zone in both primary (Fig. 5a, b, and b0 ) and secondary (Fig. 5c and d) follicles. However, distal to the precortex, IRS expression was attenuated (Fig. 5a, a0 , and d). More distally, KRT27 mRNA reappeared in Huxley’s layer and reached a maximum at the most distal region of expression (Fig. 5a–a00 and d). The onset of expression was observed more proximally on the inner side of curved secondary follicles (Fig. 5d), but was relatively symme-

Fig. 5. Localisation of KRT27 and TCHH mRNA in wool follicles. KRT27 expression in a longitudinally sectioned anagen primary follicle (a and b) with an enlargement of the follicle narrowing (a0 ) and distal expression region (a00 ); expression in the most proximal region of the IRS (b) with enlargement (b0 ); expression in a straight (c) and curved (d) secondary follicle; DISH signal surrounding (e) or proximal to (f) the brush-end-forming cortex with enlargement (f’). TCHH expression in an anagen primary follicle (g) with an enlargement of expression in the follicle narrowing (g0 ) and a more distal region (g00 ); expression in the proximal region of primary (h) and secondary (i) follicles with enlargements (h0 and h00 ). Longitudinal and transverse sections from face (j and k) and leg (l) show expression between primary and secondary follicles of these bodysites. Arrows indicate cessation of expression in Henle’s layer (h, h00 , and i). Block arrows in a0 , d, g and g0 indicate the follicle shoulder region where attenuation of expression was observed. The dotted line in (d) and (i) represents the line of Auber. (c), (e) and (f) are counterstained with eosin; others with nuclear fast red. Bars indicate 50 mm.

ARTICLE IN PRESS
Z. Yu et al. / Differentiation 77 (2009) 307–316 313

trical in straight follicles (Fig. 5a–c). During late catagen KRT27 expression was only seen in cells surrounding, and eventually proximal to the brush-end-forming cortex (Fig. 5e–f0 ), before ceasing in telogen follicles. TCHH mRNA was detected in all three IRS layers in primary follicles as well as in the medullary cells above the precortex (Fig. 5g and h). The most proximal expression commenced in the ?attened IRS cells at the base of the bulb, then slightly more distally in the elongated and enucleated cells of the central Huxley’s layer. At the line of Auber, nucleated IRS cuticle cells showed strong signal (Fig. 5h and h0 ). Attenuation of expression in Henle’s layer, similar to that of KRT27, was seen at the level of the DP apex, but became stronger in Huxley’s layer and IRS cuticle more distally (Fig. 5g0 and g00 ). In curved follicles, TCHH expression commenced more proximally in Henle’s layer on the inside of the bulb de?ection and terminated earlier (Fig. 5h and i). The more deeply anchored primary follicles showed longer expression zones than in the secondary follicles (Fig. 5j). Expression patterns were similar in follicle populations derived from the lower leg (Fig. 5k) and the mid-side of the trunk (Fig. 5l).

KRTAP6-1 (Fig. 6c) and KRT38 (Fig. 6d) were expressed in the orthocortex, although KRT38 expression was generally restricted to a much smaller area. No clear association of KRT31 expression with Janus Green was found (Fig. 6f). KRT85 mRNA expression and Janus Green staining were on opposite sides of the cortex, but they were only rarely observed simultaneously due to the limited overlap between the two zones (not shown). Assignment of KRT35 mRNA to either ortho- or para-cortex was not possible, due to its limited proximal expression zone (Fig. 7).

4. Discussion Identi?cation of the major classes of wool KIFs and KAPs in the cortex and cuticle was pioneered with the fractionation of solubilised wool proteins (Fraser et al., 1972; Powell et al., 1989). Later, other KIF and KAP genes expressed in these structures were isolated and sequenced (Dowling et al., 1986; Wilson et al., 1988; Sparrow et al., 1989, 1992; MacKinnon et al., 1990; Powell et al., 1992; Fratini et al., 1993, 1994; Jenkins and Powell, 1994; Powell and Beltrame, 1994). More recently ovine KRT25-28, which encode type I KIFs in the IRS, have also been described (Bawden et al., 2001). Expression of some of these genes has been mapped by in situ hybridisation (Rogers, 2004; Bawden et al., 2001; Powell and Beltrame, 1994; Powell et al., 1992; MacKinnon et al., 1990; Powell and Rogers, 1997). In this study, contig sequences derived from sheep skin cDNA libraries have enabled the identi?cation of three novel sheep KIFs: KRT27, KRT35 and KRT38 corresponding to known human homologues (Rogers et al., 1998; Langbein et al., 2006). Of these, K27 has the highest level of homology between the two species, followed by K35, whereas K38 is more degenerate, especially in the tail domain. Sheep K27 shares features of other IRS KIF proteins in having a cysteine and glycine composition that is intermediate between hair/wool and epithelial keratins (Bawden et al., 2001; Langbein et al., 2006). The low cysteine content in the head and tail domains and the unusual helix termination motif (Porter et al., 2004; Rogers et al., 2004b) would allow for alternate KIF and KAP molecular interactions during the formation of IRS, which disintegrates more distally. The cDNA contig sequences for KRT31 and KRT85 (EU216425 and EU216428) encode almost identical proteins as previously reported (Dowling et al., 1986; Sparrow et al., 1992). KRTAP4-3 was isolated by genomic cloning. The 1.6 kb mRNA observed by NBH was consistent with that predicted from the gene. The encoded ultra-high sulphur protein has a longer serineand cysteine-rich internal sequence than any other ovine or human member of the family. A large and complex family, as reported for human KAP4 (Rogers et al., 2001), is indicated by an additional, faint signal detected by NBH and the presence of a number of other cDNAs in the ovine contig library, which encode proteins identical at both N- and C-termini but with different internal repeats (unpublished data). Nevertheless, KRTAP4-3 appears to be the predominant expressed species as assessed by NBH. The expression patterns of keratin genes in this study are principally based on longitudinal sections, but con?rmed by numerous transverse sections at various depths in the skin. The closest distances of individual keratin expression zones to the proximal end of the anagen bulb re?ect the sequential keratinisation program undertaken by differentiating keratinocytes (Powell et al., 1992). On this basis, the earlier differentiation of the IRS supports the postulated role of this structure in shaping the developing hair shaft (Auber, 1951; Langbein et al., 2006). Slightly more distally in the lower bulb, the differentiation of ?breforming cells is marked by the expression of KRT35 and KRT85, and later, other KIF and KAP genes in the cortex and ?bre cuticle

3.3. Asymmetrical expression and Janus Green staining Janus Green staining of the paracortex was seen only above the mid-keratogenous zone. The localisation of KRTAP4-3 mRNA in the cortex of secondary follicles was coincident with the paracortex as identi?ed by Janus Green staining (Fig. 6a and b). In contrast,

Fig. 6. Relationship of gene expression localisation with Janus Green staining in secondary follicles. KRTAP4-3 (a), KRTAP6-1 (c), KRT38 (d) and KRT31 (f) expression in transverse sections of follicles from mid-side with Janus Green staining in respective adjacent sections (b, e and g). Bars indicate 50 mm.

ARTICLE IN PRESS
314 Z. Yu et al. / Differentiation 77 (2009) 307–316

Fig. 7. Schematic summary of KIF and KAP gene expression in wool follicles. Regions of gene expression in a large, straight and medullated primary follicle (a), and in a smaller, curved and non-medullated secondary follicle (b). The zones of follicle and ?bre formation are indicated on the vertical axis; the concentric tissue layers within the follicle are shaded in grey and labelled at the top. The coloured bars indicate expression zones along the longitudinal follicle axis (but not across the transverse dimension). Type II KIF gene, KRT85, is represented in blue. Type I genes are in red, with KRT38 in darker red. The expression zones of matrix protein genes KRTAP4-3, KAPRT6-1 and TCHH are shown in orange, green and yellow, respectively. Gene expression zones with dashed borders denote a variable level or pattern. The striped pattern for KRTAP6-1 indicates expression that is usually asymmetrical. Note, in secondary follicles, the consistent asymmetry of KRTAP4-3, KRTAP6-1 and KRT38, and the more proximal localisation of expression zones of other genes on the inside of the bulb de?ection. The region of Janus Green staining in both the primary and secondary follicles begins above the light-dashed line, while the thicker dashed line across the bulbs indicates the line of Auber. For simplicity, the CL and the three separate IRS layers as well as the retrocurvature for the secondary follicle are not shown. The relative position and size of the primary and secondary follicles are not drawn to scale. (For interpretation of the references to colour in this ?gure legend, the reader is referred to the web version of this article.)

(Fig. 7). The proteins for ovine K31, K85 (Powell and Rogers, 1997), trichohyalin (Hamilton et al., 1991) and, more recently, for K38 (J. Plowman, personal communication) have been described. While their distributions in the wool follicle are unknown, the strong concordance between keratin mRNA and protein synthesis in human hair follicles (Langbein et al., 1999, 2001) would also suggest a similar association in wool follicles. During catagen induced by a change in photoperiod, downregulation of these genes was characterised by a retreat of expression zones from the distal margins, with mRNA detectable in the lower follicle until late catagen. The selective involvement of some genes (KRT27, KRT31, KRT85 and KRTAP6-1), but not others (KRT35, KRT38 and KRTAP4-3) with the formation of ?bre brushend, not only suggests special biochemical and physical properties of the brush-end, but also a highly ordered regulation of expression during follicle regression. In contrast, the withdrawal of KRT31 expression from the proximal margin in cultured human scalp follicles undergoing regression (Bowden et al., 1998) is associated with failure to produce brush-ends, highlighting the disparities between in vivo and in vitro follicle regression (Philpott

et al., 1996). Subsequently, during follicle reactivation, keratin expression in keratinocytes forming the hair cone was not observed until mid-proanagen, as with mouse KRT75 in the CL (Gu and Coulombe, 2007), indicating a restricted level of differentiation in cortical cells until late proanagen. In primary wool follicles, the expression patterns of KIF and KAP genes are generally similar to their orthologues in human hair (Langbein et al., 1999, 2001). However, some differences are also apparent. The cessation of KRT27 and TCHH expression in Henle’s layer distal to the precortex, attenuation at the shoulder of the bulb and up-regulation in the more distal region of Huxley’s layer were not seen in the human (Langbein et al., 2003, 2006). The expression of KRT35 was more distal in the ?bre cuticle than in the cortex in comparison to concomitant termination in the human hair. Symmetrical expression of KRT31 in some primary follicles resembles that in human hair (Langbein et al., 1999), while the asymmetrical pattern in the others was similar to chimpanzee and gorilla hair (Winter et al., 2001). In comparison, the expression of KRTAP6-1 is asymmetric in most, but not all, primary follicles. Therefore, the variable patterns of KRT31 and of KRTAP6-1

ARTICLE IN PRESS
Z. Yu et al. / Differentiation 77 (2009) 307–316 315

expression re?ect a degree of diversity in the primary wool follicle population possibly related to the relative ratios and arrangements of ortho- and paracortical cells. This is consistent with a high proportion of orthocortex (Orwin et al., 1984; Dick and Sumner, 1995) and the limited positive Janus Green staining we observed in these coarse ?bres. An elongated KAP5 expression zone in the cuticle of primary wool follicles in comparison to secondary follicles has been reported (Jenkins and Powell, 1994). However, more differences in expression between the two follicle populations were documented in this study. They were associated with bulb de?ection in secondary wool follicles and the segmentation of cortical cells into ortho- and para-cortex. In secondary follicles, the restriction of gene expression to either the paracortex (KRTAP4-3) or the orthocortex (KRTAP6-1 and KRT38) demonstrates distinctive asymmetric differentiation pathways. Asymmetric KRT38 expression in primary follicles is likely to arise from orthocortical cell differentiation as observed in secondary follicles. In contrast, K38 has been reported with an asymmetric distribution only in curved human hair (Thibaut et al., 2007). Interestingly, while KRTAP4-3 is absent from the orthocortex in secondary follicles, it is expressed throughout the cortex of primary ?bres. Such a divergence in orthocortical differentiation between follicle subpopulations suggests that the distribution of KAP4.3, with extraordinary high sulphur content and thus high potential for disulphide bonding, may play a critical role for the formation and maintenance of ?bre curvature (Parry et al., 2006). In secondary follicles, Janus Green staining occurred above the central expression zones of KRT31, KRT38, KRTAP4.3 and KRTAP6.1, at the distal edge of KRT85 and distal to KRT35 expression (Fig. 7). However, there is evidence from earlier studies that distinct differentiation pathways are already underway in the bulb and suprabulbar regions as indicated by asymmetrical distribution of structural proteins (Thibaut et al., 2005), precortical cell surface marker (Campbell et al., 1992) and enzyme activity (Chapman and Gemmell, 1971) in human and sheep follicles. The observation of more proximal appearance of KRT35, KRT85 and TCHH mRNA on the inner side of the bulb de?ection is also consistent with earlier cessation of cell growth and reduced proliferative cell mass (Fraser, 1964, 1965). The subsequent divergent keratinisation programmes, as re?ected by the differences in the macro?brillar arrangements and KAP abundance in the ortho- and paracortex, have been postulated to produce tension between opposing sides of the cortex giving rise to ?bre curvature (Kajiura et al., 2006; Caldwell et al., 2005; Fraser and Parry, 2003). The underlying molecular interactions may become even more pronounced during ?bre dehydration (Brown and Onions, 1961; Fraser and Rogers, 1954), eventually creating a more rigid paracortex on the inside of the ?bre curvature and a more pliable orthocortex on the outside (Mercer, 1953; Horio and Kondo, 1953). On the other hand, asymmetrical expression of some laterexpressed genes are also found in straight ?bres. These include KRT38 and KRT31 in chimpanzee and gorilla follicles (Langbein and Schweizer, 2005), KRT38 and KRTAP6.1 in primary Wiltshire follicles, and some KAP genes including KRTAP8.1 in human hair (Rogers et al., 2006). This suggests only the more proximally asymmetrically expressed genes such as KRT27, KRT35, KRT85 and trichohyalin are involved in the initial establishment of differentiated cortical structures that ultimately lead to ?bre curvature. Recently, asymmetrical expression of regulatory genes including Runx1 and IGFBP5 have been reported, which appear to have roles in determining mouse hair curvature (Raveh et al., 2006; Schlake, 2005). Hence, future studies involving the manipulation of the expression of both structural (Bawden et al., 1999) and regulatory genes will be required to elucidate the mechanisms underlying ?bre phenotypes (Powell et al., 1991; Rogers, 2004, 2006).

Acknowledgements This study was funded by New Zealand Foundation for Research, Science and Technology (Contract C10X0403). The authors appreciate the contributions of Tony Craven and Murray Ashby to the animal trial and sample collection as well as Pauline Hunt and David Nixon for the preparation of the line diagram. We also thank Jeff Plowman and John MacKinnon for reviewing the manuscript. References
Auber, L., 1951. The anatomy of follicle producing wool-?bre, with special reference to keratinization. Trans. R. Soc. Edinburgh 62, 191–254. Bawden, C.S., Powell, B.C., Walker, S.K., Rogers, G.E., 1999. Sheep transgenesis with keratin and non-keratin genes: expression in the wool follicle for modi?ed ?bre properties and growth rates. Exp. Dermatol. 8, 342–343. Bawden, C.S., McLaughlan, C., Nesci, A., Rogers, G., 2001. A unique type I keratin intermediate ?lament gene family is abundantly expressed in the inner root sheaths of sheep and human hair follicles. J. Invest. Dermatol. 116, 157–166. Bowden, P.E., Hainey, S.D., Parker, G., Jones, D.O., Zimonjic, D., Popescu, N., Hodgins, M.B., 1998. Characterization and chromosomal localization of human hairspeci?c keratin genes and comparative expression during the hair growth cycle. J. Invest. Dermatol. 110, 158–164. Brown, T.D., Onions, W.J., 1961. A theory for the development of wool ?bre crimp on drying. J. Text. Inst. 52, T102–T108. Caldwell, J.P., Mastronarde, D.N., Woods, J.L., Bryson, W.G., 2005. The threedimensional arrangement of intermediate ?laments in Romney wool cortical cells. J. Struct. Biol. 151, 298–305. Campbell, M.T., Dollin, A.E., Adelson, D.L., 1992. Differential lectin binding to presumptive cortical cells of the wool follicle bulb. J. Cell Sci. 102 (Pt 2), 353–360. Chapman, R.E., Gemmell, R.T., 1971. Origin of cortical segmentation in wool follicles. J. Invest. Dermatol. 57, 377–381. Craven, A.J., Ashby, M.G., Scobie, D.R., Nixon, A.J., 2007. Variation of wool characteristics across the body of New Zealand Wiltshire sheep. In: Proceedings of the NZ Soc. Anim. Prod., pp. 339–344. Dick, J.L., Sumner, R.M.W., 1995. The relationship between cortical structure and ?bre diameter in primary and secondary wool ?bres of yearling Perendale sheep. In: Proceedings of the NZ Soc. Anim. Prod., pp. 31–34. Dowling, L.M., Crewther, W.G., Inglis, A.S., 1986. The primary structure of component 8c-1, a subunit protein of intermediate ?laments in wool keratin. Relationships with proteins from other intermediate ?laments. Biochem. J. 236, 695–703. Fietz, M.J., Presland, R.B., Rogers, G.E., 1990. The cDNA-deduced amino acid sequence for trichohyalin, a differentiation marker in the hair follicle, contains a 23 amino acid repeat. J. Cell Biol. 110, 427–436. Fraser, I.E.B., 1964. Studies on the follicle bulb of ?bres I. Mitotic and cellular segmentation in the wool follicle with reference to ortho- and parasegmentation. Aust. J. Biol. Sci. 17, 521–531. Fraser, I.E.B., 1965. Cellular proliferation in the wool follicle bulb. In: Lyne, A.G., Short, B.F. (Eds.), Biology of the Skin and Hair Growth. Angus and Robertson, Sydney. Fraser, R.D., Parry, D.A., 2003. Macro?bril assembly in trichocyte (hard alpha-) keratins. J. Struct. Biol. 142, 319–325. Fraser, R.D., Rogers, G.E., 1954. The origin of segmentation in wool cortex. Biochem. Biophys. Acta 13, 297–298. Fraser, R.D., MacRae, T.P., Rogers, G.E., 1972. Keratins: Their Composition, Structure and Biosynthesis. Charles C Thomas, New York. Fraser, R.D.B., Rogers, C.E., 1955. The bilateral structure of wool cortex and its relation to crimp. Aust. J. Biol. Sci. 8, 288–299. Fratini, A., Powell, B.C., Rogers, G.E., 1993. Sequence, expression, and evolutionary conservation of a gene encoding a glycine/tyrosine-rich keratin-associated protein of hair. J. Biol. Chem. 268, 4511–4518. Fratini, A., Powell, B.C., Hynd, P.I., Keough, R.A., Rogers, G.E., 1994. Dietary cysteine regulates the levels of mRNAs encoding a family of cysteine-rich proteins of wool. J. Invest. Dermatol. 102, 178–185. Gu, L.H., Coulombe, P.A., 2007. Keratin expression provides novel insight into the morphogenesis and function of the companion layer in hair follicles. J. Invest. Dermatol. 127, 1061–1073. Hamilton, E.H., Payne Jr., R.E., O’Keefe, E.J., 1991. Trichohyalin: presence in the granular layer and stratum corneum of normal human epidermis. J Invest. Dermatol. 96, 666–672. Horio, M., Kondo, T., 1953. Crimping of wool ?bres. Text. Res. J. 23, 373–387. Jenkins, B.J., Powell, B.C., 1994. Differential expression of genes encoding a cysteine-rich keratin family in the hair cuticle. J. Invest. Dermatol. 103, 310–317. Kajiura, Y., Watanabe, S., Itou, T., Nakamura, K., Iida, A., Inoue, K., Yagi, N., Shinohara, Y., Amemiya, Y., 2006. Structural analysis of human hair single ?bres by scanning microbeam SAXS. J. Struct. Biol.

ARTICLE IN PRESS
316 Z. Yu et al. / Differentiation 77 (2009) 307–316

Kaplin, I.J., Whiteley, K.J., 1978. An electron microscope study of ?bril: matrix arrangements in high- and low-crimp wool ?bres. Aust. J. Biol. Sci. 31, 231–240. Keane, O.M., Zadissa, A., Wilson, T., Hyndman, D.L., Greer, G.J., Baird, D.B., McCulloch, A.F., Crawford, A.M., McEwan, J.C., 2006. Gene expression pro?ling of naive sheep genetically resistant and susceptible to gastrointestinal nematodes. BMC Genomics 7, 42–53. Langbein, L., Schweizer, J., 2005. Keratins of the human hair follicle. Int. Rev. Cytol. 243, 1–78. Langbein, L., Rogers, M.A., Winter, H., Praetzel, S., Beckhaus, U., Rackwitz, H.R., Schweizer, J., 1999. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle. J. Biol. Chem. 274, 19874–19884. Langbein, L., Rogers, M.A., Winter, H., Praetzel, S., Schweizer, J., 2001. The catalog of human hair keratins. II. Expression of the six type II members in the hair follicle and the combined catalog of human type I and II keratins. J. Biol. Chem. 276, 35123–35132. Langbein, L., Rogers, M.A., Praetzel, S., Aoki, N., Winter, H., Schweizer, J., 2002. A novel epithelial keratin, hK6irs1, is expressed differentially in all layers of the inner root sheath, including specialized Huxley cells (Flugelzellen) of the human hair follicle. J. Invest. Dermatol. 118, 789–799. Langbein, L., Rogers, M.A., Praetzel, S., Winter, H., Schweizer, J., 2003. K6irs1, K6irs2, K6irs3, and K6irs4 represent the inner-root-sheath-speci?c type II epithelial keratins of the human hair follicle. J. Invest. Dermatol. 120, 512–522. Langbein, L., Rogers, M.A., Praetzel-Wunder, S., Helmke, B., Schirmacher, P., Schweizer, J., 2006. K25 (K25irs1), K26 (K25irs2), K27 (K25irs3), and K28 (K25irs4) represent the Type I inner root sheath keratins of the human hair follicle. J. Invest. Dermatol. 126, 2377–2386. Lee, S.C., Lee, J.B., Kook, J.P., Seo, J.J., Nam, K.I., Park, S.S., Kim, Y.P., 1999. Expression of differentiation markers during fetal skin development in humans: immunohistochemical studies on the precursor proteins forming the corni?ed cell envelope. J. Invest. Dermatol. 112, 882–886. MacKinnon, P.J., Powell, B.C., Rogers, G.E., 1990. Structure and expression of genes for a class of cysteine-rich proteins of the cuticle layers of differentiating wool and hair follicles. J. Cell Biol. 111, 2587–2600. Mercer, E.H., 1953. The heterogeneity of the keratin ?bres. Text. Res. J. 23, 388–397. Miller, M.A., Kolb, P.E., Raskind, M.A., 1993. A method for simultaneous detection of multiple mRNAs using digoxigenin and radioisotopic cRNA probes. J. Histochem. Cytochem. 41, 1741–1750. Nixon, A.J., 1993. A method for determining the activity state of hair follicles. Biotech. Histochem. 68, 316–325. Nixon, A.J., Ford, C.A., Oldham, J.M., Pearson, A.J., 1997. Localisation of insulin-like growth factor receptors in skin follicles of sheep (Ovis aries) and changes during an induced growth cycle. Comp. Biochem. Physiol. 118A, 1247–1257. Nixon, A.J., Choy, V.H., Ford, C.A., Pearson, A.J., 1999. Prolactin receptor and insulinlike growth factor expression in wool follicles. Exp. Dermatol. 8, 355–357. Orwin, F.G., Woods, J.L., Ranford, S.L., 1984. Cortical cell types and their distribution in wool ?bres. Aust. J. Biol. Sci. e37, 237–255. Parry, A.L., Nixon, A.J., Craven, A.J., Pearson, A.J., 1995. The microanatomy, cell replication, and keratin gene expression of hair follicles during a photoperiodinduced growth cycle in sheep. Acta Anat. 154, 283–299. Parry, D.A., Smith, T.A., Rogers, M.A., Schweizer, J., 2006. Human hair keratinassociated proteins: sequence regularities and structural implications. J. Struct. Biol. 155, 361–369. Pearson, A.J., Parry, A.L., Ashby, M.G., Choy, V.J., Wildermoth, J.E., Craven, A.J., 1996. Inhibitory effort of increased photoperiod on wool follicle growth. J. Endocrinol. 148, 157–166. Philpott, M.P., Sanders, D.A., Kealey, T., 1996. Whole hair follicle culture. Dermatol. Clin. 14, 595–607. Porter, R.M., Gandhi, M., Wilson, N.J., Wood, P., McLean, W.H.I., Lane, E.B., 2004. Functional analysis of keratin components in the mouse hair follicle inner root sheath. Br. J. Dermatol. 150, 195–204. Powell, B., Kuczek, E.S., Crocker, L., O’Donnell, M., Rogers, G.E., 1989. Keratin gene expression in wool ?bre development. In: Rogers, G.E., Reis, P.J., Ward, K.A., Marshall, R.C. (Eds.), The Biology of Wool and Hair. Chapman & Hall Ltd., Cambridge, pp. 325–335. Powell, B., Crocker, L., Rogers, G., 1992. Hair follicle differentiation: expression, structure and evolutionary conservation of the hair type II keratin intermediate ?lament gene family. Development 114, 417–433.

Powell, B.C., 1996. The keratin proteins of wool and hair. Wool Technol. Sheep Breed. 44, 100–118. Powell, B.C., Beltrame, J.S., 1994. Characterization of a hair (wool) keratin intermediate ?lament gene domain. J. Invest. Dermatol. 102, 171–177. Powell, B.C., Rogers, G.E., 1997. The Role of Keratin Proteins and Their Genes in the Growth, Structure and Properties of Hair. Formation and Structure of Human Hair. Birkhauser Verlag, Basel, Switzerland, pp. 59–148. Powell, B.C., Nesci, A., Rogers, G.E., 1991. Regulation of keratin gene expression in hair follicle differentiation. In: Stenn, K.S., Messenger, A.G., Baden, H.P. (Eds.), The Molecular and Structural Biology of Hair. The New York Academy of Sciences, New York. Raveh, E., Cohen, S., Levanon, D., Negreanu, V., Groner, Y., Gat, U., 2006. Dynamic expression of Runx1 in skin affects hair structure. Mech. Dev. 123, 842–850. Rogers, G.E., 1959. Electron microscopy of wool. J. Ultrastruct. Res. 2, 309–330. Rogers, G.E., 2004. Hair follicle differentiation and regulation. Int. J. Dev. Biol. 48, 163–170. Rogers, G.E., 2006. Biology of the wool follicle: an excursion into a unique tissue interaction system waiting to be re-discovered. Exp. Dermatol. 15, 931–949. Rogers, M.A., Winter, H., Wolf, C., Heck, M., Schweizer, J., 1998. Characterization of a 190-kilobase pair domain of human type I hair keratin genes. J. Biol. Chem. 273, 26683–26691. Rogers, M.A., Winter, H., Langbein, L., Wolf, C., Schweizer, J., 2000. Characterization of a 300 kbp region of human DNA containing the type II hair keratin gene domain. J. Invest. Dermatol. 114, 464–472. Rogers, M.A., Langbein, L., Winter, H., Ehmann, C., Praetzel, S., Korn, B., Schweizer, J., 2001. Characterization of a cluster of human high/ultrahigh sulfur keratinassociated protein genes embedded in the type I keratin gene domain on chromosome 17q12-21. J. Biol. Chem. 276, 19440–19451. Rogers, M.A., Langbein, L., Winter, H., Beckmann, I., Praetzel, S., Schweizer, J., 2004a. Hair keratin associated proteins: characterization of a second high sulfur KAP gene domain on human chromosome 21. J. Invest. Dermatol. 122, 147–158. Rogers, M.A., Winter, H., Langbein, L., Bleiler, R., Schweizer, J., 2004b. The human type I keratin gene family: characterization of new hair follicle speci?c members and evaluation of the chromosome 17q21.2 gene domain. Differentiation 72, 527–540. Rogers, M.A., Langbein, L., Praetzel-Wunder, S., Winter, H., Schweizer, J., 2006. Human hair keratin-associated proteins (KAPs). Int. Rev. Cytol. 251, 209–263. Rogers, M.A., Winter, H., Langbein, L., Wollschlager, A., Praetzel-Wunder, S., JaveSuarez, L.F., Schweizer, J., 2007. Characterization of human KAP24.1, a cuticular hair keratin-associated protein with unusual amino-acid composition and repeat structure. J. Invest. Dermatol. 127, 1197–1204. Schlake, T., 2005. Segmental Igfbp5 expression is speci?cally associated with the bent structure of zigzag hairs. Mech. Dev. 122, 988–997. Schweizer, J., Bowden, P.E., Coulombe, P.A., Langbein, L., Lane, E.B., Magin, T.M., Maltais, L., Omary, M.B., Parry, D.A., Rogers, M.A., Wright, M.W., 2006. New consensus nomenclature for mammalian keratins. J. Cell Biol. 174, 169–174. Sparrow, L.G., Robinson, C.P., McMahon, D.T., Rubira, M.R., 1989. The amino acid sequence of component 7c, a type II intermediate-?lament protein from wool. Biochem. J. 261, 1015–1022. Sparrow, L.G., Robinson, C.P., Caine, J., McMahon, D.T., Strike, P.M., 1992. Type II intermediate-?lament proteins from wool. The amino acid sequence of component 5 and comparison with component 7c. Biochem. J. 282 (Pt 1), 291–297. Staden, R., 1984. Measurements of the effects that coding for a protein has on a DNA sequence and their use for ?nding genes. Nucleic Acids Res. 12, 551–567. Thibaut, S., Gaillard, O., Bouhanna, P., Cannell, D.W., Bernard, B.A., 2005. Human hair shape is programmed from the bulb. Br. J. Dermatol. 152, 632–638. Thibaut, S., Barbarat, P., Leroy, F., Bernard, B.A., 2007. Human hair keratin network and curvature. Int. J. Dermatol. 46 (Suppl. 1), 7–10. Wilson, B.W., Edwards, K.J., Sleigh, M.J., Byrne, C.R., Ward, K.A., 1988. Complete sequence of a type-I micro?brillar wool keratin gene. Gene 73, 21–31. Winter, H., Langbein, L., Krawczak, M., Cooper, D.N., Jave-Suarez, L.F., Rogers, M.A., Praetzel, S., Heidt, P.J., Schweizer, J., 2001. Human type I hair keratin pseudogene phihHaA has functional orthologs in the chimpanzee and gorilla: evidence for recent inactivation of the human gene after the Pan-Homo divergence. Hum. Genet. 108, 37–42.


相关文章:
HQ283085.1 keratin 81
TITLE Annotation of the wool keratin intermediate filament gene set and their patterns of expression JOURNAL REFERENCE AUTHORS Unpublished 2 (bases 1 to 1360...
中间纤维intermediate filament
(keratin filament),存在于上皮细胞中;(2)波形纤维...(intermediate filament associated protein, IFAP)是...Expression patterns of... 10页 免费 filament ...
生技常用缩写词
keratin 表皮角蛋白 ELISA enzyme-liked immunosorbent...intermediate filament 中间丝 Ig immunoglobulin 免疫...expression of hydrogenion cincentration 表示氢离子...
医学细胞学英语
Intermediate filament IF 中间丝 Tubulin 微管蛋白 Microtubule-associated protein MAP 微管相关蛋白 Protofilament 原纤维 Globular actin 球形肌动蛋白 Keratin ...
组胚英语词汇汇总
intermediate filament 中间丝 keratin filament 角蛋白丝 desmin filament 结蛋白...associated glycoprotein,MAG 髓磷质连结糖蛋白 microglial cell 小胶质细胞 ...
缩写词
keratin 表皮角蛋白 ELISA enzyme-liked immunosorbent...–associated lymphoid tissue 胃肠道相关淋巴组织 GAR...intermediate filament 中间丝 Ig immunoglobulin 免疫...
医学单词缩写
keratin 表皮角蛋白 ELISA enzyme-liked immunosorbent...–associated lymphoid tissue 胃肠道相关淋巴组织 GAR...intermediate filament 中间丝 Ig immunoglobulin 免疫...
更多相关标签:
keratin | keratinized | keratinization | keratin洗发水 | keratin treatment | keratin角蛋白护理 | filament | actin filament |